![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-2941-1 |
||||||||
Accession | MI0013491 (change log) | |||||||
Description | Aedes aegypti miR-2941-1 stem-loop | |||||||
Gene family | MIPF0000842; mir-2941 | |||||||
Literature search |
2 open access papers mention aae-mir-2941-1 | |||||||
Stem-loop |
aug a acc u -ug a ugauuuuu 5' gauua guugu ac uucgugg uuuag cguauuaca u ||||| ||||| || ||||||| ||||| ||||||||| 3' cugau uaacg ug aggcacc agauc gcaugaugu g cua a -gu u uca g caauacaa |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence aae-miR-2941 |
|
Accession | MIMAT0014286 |
Sequence |
65 - uaguacggcuagaacuccacgg - 86 |
Deep sequencing | 54 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|