Stem-loop sequence aae-mir-33

AccessionMI0013493 (change log)
DescriptionAedes aegypti miR-33 stem-loop
Gene family MIPF0000070; mir-33
Literature search

3 open access papers mention aae-mir-33
(5 sentences)

Stem-loop 
        c  -g          uu c        uuu c   c 
5' ccacc gg  ugcauuguag  g auugcacu   g guu g
   ||||| ||  ||||||||||  | ||||||||   | |||  
3' ggugg cc  acguaacguc  c uaacgugg   c caa a
        a  ga          uu a        --- a   u
Get sequence
Deep sequencing
9581 reads, 500 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.487: 351648-351727 [+]
intergenic
Database links

Mature sequence aae-miR-33

Accession MIMAT0014287
Sequence

9 -  

gugcauuguaguugcauugca

 - 29

Get sequence
Deep sequencing9473 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).