Stem-loop sequence aae-mir-2943-1

AccessionMI0013507 (change log)
DescriptionAedes aegypti miR-2943-1 stem-loop
Gene family MIPF0001056; mir-2943
Literature search

2 open access papers mention aae-mir-2943-1
(9 sentences)

Stem-loop
       a ug    uaa     cacuu    g    guuuc 
5' ccca u  augu   guagg     gcag caaa     a
   |||| |  ||||   |||||     |||| ||||     u
3' gggu a  uaca   caucc     cguc guuu     u
       g gu    uuc     uuuuu    a    aacac 
Get sequence
Deep sequencing
82 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.348: 480917-480997 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-2943-1
aae-mir-2943-1supercont1.348: 480917-480997 [+]
aae-mir-2943-2supercont1.348: 481079-481149 [+]
Database links

Mature sequence aae-miR-2943

Accession MIMAT0014301
Sequence

12 - 

uuaaguaggcacuugcaggcaaa

 - 34

Get sequence
Deep sequencing154 reads, 2 experiments
Evidence experimental; 454 [1]

References

1