Stem-loop sequence aae-mir-219

AccessionMI0013513 (change log)
DescriptionAedes aegypti miR-219 stem-loop
Gene family MIPF0000044; mir-219
Literature search

1 open access papers mention aae-mir-219
(3 sentences)

Stem-loop
   u   u    c  au      aa           --uu    uc 
5'  uuc agcu ug  ugucca  cgcaauucuug    uuau  g
    ||| |||| ||  ||||||  |||||||||||    ||||   
3'  aag ucgg gc  acaggu  guguugagaac    agua  a
   a   c    u  cu      ca           cuau    ua 
Get sequence
Deep sequencing
9583 reads, 500 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.368: 610327-610412 [+]
intergenic
Database links

Mature sequence aae-miR-219

Accession MIMAT0014307
Sequence

11 - 

ugauuguccaaacgcaauucuug

 - 33

Get sequence
Deep sequencing8783 reads, 2 experiments
Evidence experimental; 454 [1]

References

1