Stem-loop sequence aae-mir-309b

AccessionMI0013526 (change log)
DescriptionAedes aegypti miR-309b stem-loop
Gene family MIPF0000140; mir-3
Literature search

2 open access papers mention aae-mir-309b
(2 sentences)

Stem-loop
   u      u      cc       --   --     u 
5'  uaugcg caaacu  guucagu  ugg  uggag c
    |||||| ||||||  |||||||  |||  ||||| a
3'  auacgc guuuga  cggguca  acu  accuu u
   a      u      ua       cu   ga     u 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.464: 825629-825699 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-309b
aae-mir-286asupercont1.464: 824995-825091 [+]
aae-mir-2944bsupercont1.464: 825313-825374 [+]
aae-mir-2944asupercont1.464: 825450-825511 [+]
aae-mir-309bsupercont1.464: 825629-825699 [+]
Database links

Mature sequence aae-miR-309b-5p

Accession MIMAT0014319
Previous IDsaae-miR-309b*
Sequence

6 - 

cgucaaacuccguucaguuggug

 - 28

Get sequence
Evidence experimental; 454 [1]

Mature sequence aae-miR-309b-3p

Accession MIMAT0014320
Previous IDsaae-miR-309b
Sequence

47 - 

ucacugggcauaguuugucgca

 - 68

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; 454 [1]

References

1