Stem-loop sequence hsa-mir-514b

Accession

MI0014251 (change log)

Symbol

HGNC:MIR514B

Description

Homo sapiens miR-514b stem-loop

Gene family

MIPF0000130; mir-506

Literature search

11 open access papers mention hsa-mir-514b
(18 sentences)

Stem-loop

         g      u    -     gagg         g a 
5' caugug uacucu cuca agagg    caaucaugu u a
   |||||| |||||| |||| |||||    ||||||||| |  
3' guacac augagg gagu ucucc    guuaguaua a u
         a      u    g     -aca         g u 

Deep sequencing

183614 reads, 574 reads per million, 76 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 147250151-147250230 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-514b

• hsa-mir-509-3: chrX: 147259652-147259726 [-]
• hsa-mir-509-2: chrX: 147258760-147258850 [-]
• hsa-mir-514b: chrX: 147250151-147250230 [-]

Database links

• EntrezGene:MIR514B
• HGNC:MIR514B
• RNAcentral:URS000075B7D5_9606
• miRBase Tracker:MI0014251

Mature sequence hsa-miR-514b-5p

• Accession: MIMAT0015087
• Sequence: 13 - uucucaagagggaggcaaucau - 34
• Deep sequencing: 1917 reads, 49 experiments
• Evidence: experimental; Illumina [1-4]
• Database links:
  • RNAcentral:URS00003AA851_9606
• Predicted targets:
  • TargetMiner:hsa-miR-514b-5p
  • TargetScanVert:hsa-miR-514b-5p
  • miRDB:hsa-miR-514b-5p
  • microrna.org:hsa-miR-514b-5p

Mature sequence hsa-miR-514b-3p

• Accession: MIMAT0015088
• Sequence: 50 - auugacaccucugugagugga - 70
• Deep sequencing: 181689 reads, 53 experiments
• Evidence: experimental; Illumina [1,3-4]
• Predicted targets:
  • TargetMiner:hsa-miR-514b-3p
  • TargetScanVert:hsa-miR-514b-3p
  • miRDB:hsa-miR-514b-3p
  • microrna.org:hsa-miR-514b-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).
4. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).