![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-514b |
||||||||
Accession | MI0014251 (change log) | |||||||
Symbol | HGNC:MIR514B | |||||||
Description | Homo sapiens miR-514b stem-loop | |||||||
Gene family | MIPF0000130; mir-506 | |||||||
Literature search |
![]()
11 open access papers mention hsa-mir-514b | |||||||
Stem-loop |
g u - gagg g a 5' caugug uacucu cuca agagg caaucaugu u a |||||| |||||| |||| ||||| ||||||||| | 3' guacac augagg gagu ucucc guuaguaua a u a u g -aca g u |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-miR-514b-5p |
|
Accession | MIMAT0015087 |
Sequence |
13 - uucucaagagggaggcaaucau - 34 |
Deep sequencing | 1917 reads, 49 experiments |
Evidence | experimental; Illumina [1-4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-514b-3p |
|
Accession | MIMAT0015088 |
Sequence |
50 - auugacaccucugugagugga - 70 |
Deep sequencing | 181689 reads, 53 experiments |
Evidence | experimental; Illumina [1,3-4] |
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
3 | |
4 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|