Stem-loop sequence aly-MIR156a

AccessionMI0014502 (change log)
DescriptionArabidopsis lyrata miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
      uu     u  gug      -   -     ------     aac   -aa   a         -   -         a   ---      uu    ua 
5' ggg  gguug ga   aaagag uug ggaca      agaga   gca   gaa cugacagaa gag agugagcac caa   aggcaa  ugca  u
   |||  ||||| ||   |||||| ||| |||||      |||||   |||   ||| ||||||||| ||| ||||||||| |||   ||||||  ||||   
3' cuc  cuaac cu   uuucuc agc ccugu      ucucu   cgu   cuu gacugucuu cuc ucacucgug guu   uucguu  acgu  c
      -u     u  --g      u   u     ccgguu     agu   ggc   a         u   g         c   cuc      -u    ua 
Get sequence
Deep sequencing
377 reads, 1.2e+04 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 3693766-3693949 [-]
intergenic
Database links

Mature sequence aly-miR156a-5p

Accession MIMAT0017397
Previous IDsaly-miR156a
Sequence

49 - 

ugacagaagagagugagcac

 - 68

Get sequence
Deep sequencing240 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR156a-3p

Accession MIMAT0017398
Previous IDsaly-miR156a*
Sequence

111 - 

gcucacugcucuuucugucaga

 - 132

Get sequence
Deep sequencing137 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2