Stem-loop sequence aly-MIR156c

AccessionMI0014504 (change log)
DescriptionArabidopsis lyrata miR156c stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
     aua    -        -    -         a   ---     cuu     g 
5' gc   gaaa cugacaga agag agugagcac caa   aggca   ugcau u
   ||   |||| |||||||| |||| ||||||||| |||   |||||   ||||| u
3' cg   cuuu gacugucu ucuc ucacucgug guu   uucgu   acgua c
     --g    a        a    g         c   cuc     -uu     g 
Get sequence
Deep sequencing
380 reads, 1.22e+04 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 4138775-4138876 [+]
intergenic
Database links

Mature sequence aly-miR156c-5p

Accession MIMAT0017401
Previous IDsaly-miR156c
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Deep sequencing240 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR156c-3p

Accession MIMAT0017402
Previous IDsaly-miR156c*
Sequence

74 - 

gcucacugcucuaucugucaga

 - 95

Get sequence
Deep sequencing140 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2