Stem-loop sequence aly-MIR156e

AccessionMI0014506 (change log)
DescriptionArabidopsis lyrata miR156e stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   guag   g       ua    -  ---         -                    ggu   uu    ---     uuu 
5'     agu ugaaagg  agag ga   ggugacaga agagagugagcacacauggu   uuc  gcau   gcuuu   u
       ||| |||||||  |||| ||   ||||||||| ||||||||||||||||||||   |||  ||||   |||||   u
3'     uua acuuuuc  ucuc cu   ccacugucu ucucucauucguguguaucg   aag  cgua   cggga   a
   --ca   a       uc    u  ucc         c                    ---   uu    cuu     uua 
Get sequence
Deep sequencing
242 reads, 7.8e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 4871349-4871498 [+]
intergenic
Database links

Mature sequence aly-miR156e-5p

Accession MIMAT0017405
Previous IDsaly-miR156e
Sequence

26 - 

ugacagaagagagugagcac

 - 45

Get sequence
Deep sequencing240 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR156e-3p

Accession MIMAT0017406
Previous IDsaly-miR156e*
Sequence

105 - 

gcuuacucucucucugucacc

 - 125

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2