Stem-loop sequence aly-MIR156f

AccessionMI0014507 (change log)
DescriptionArabidopsis lyrata miR156f stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
       g   u      ag       ugaa  ------      a        -uug  u  u   uaauu  ---u         -                    ggcu   uu   uauu   u 
5' guau uga auuaag  guauaua    uc      auaaau uggauggu    au ga gag     ga    ggugacaga agagagugagcacacauggu    uuc  gca    uga g
   |||| ||| ||||||  |||||||    ||      |||||| ||||||||    || || |||     ||    ||||||||| ||||||||||||||||||||    |||  |||    ||| g
3' caua guu uaguuu  cauauau    ag      uauuua auuuacca    ua cu cuc     cu    ccacugucu ucucucacucguguguaucg    aag  cgu    acu u
       -   u      aa       --ug  auauuu      a        caua  u  -   --ucu  uccc         a                    ----   uu   ----   u 
Get sequence
Deep sequencing
243 reads, 7.8e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 11884572-11884799 [+]
intergenic
Database links

Mature sequence aly-miR156f-5p

Accession MIMAT0017407
Previous IDsaly-miR156f
Sequence

68 - 

ugacagaagagagugagcac

 - 87

Get sequence
Deep sequencing240 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR156f-3p

Accession MIMAT0017408
Previous IDsaly-miR156f*
Sequence

139 - 

gcucacucucuaucugucacc

 - 159

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2