Stem-loop sequence aly-MIR156h

AccessionMI0014509 (change log)
DescriptionArabidopsis lyrata miR156h stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   -gaa   u  a      -            -a     g uua      ag 
5'     aug ug cagaag aaagagagcaca  ccugg a   gcaaaa  a
       ||| || |||||| ||||||||||||  ||||| |   ||||||   
3'     uac ac gucuuc uuucucucgugu  gggcu u   cguuuu  u
   cuac   c  c      c            ga     g ucc      ga 
Get sequence
Deep sequencing
217 reads, 7.4e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 17184369-17184467 [-]
intergenic
Database links

Mature sequence aly-miR156h-5p

Accession MIMAT0017411
Previous IDsaly-miR156h
Sequence

8 - 

ugacagaagaaagagagcac

 - 27

Get sequence
Deep sequencing217 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR156h-3p

Accession MIMAT0017412
Previous IDsaly-miR156h*
Sequence

73 - 

gcucucuuuccuucugccacc

 - 93

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2