Stem-loop sequence aly-MIR157d

AccessionMI0014513 (change log)
DescriptionArabidopsis lyrata miR157d stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
       -u       --ua        u     u ------u   u c         -           ua    ugauaugcaaaacacacacauauaugugcuucuaauuguauuucauacuuaacaucaau 
5' augu  guaugua    guggaggg gauag g       ggu g ugacagaag auagagagcac  agga                                                           g
   ||||  |||||||    |||||||| ||||| |       ||| | ||||||||| |||||||||||  ||||                                                           u
3' uaca  uauacau    caucucuc uuauc c       cca c acugucuuc uaucucucgug  uccu                                                           u
       cu       uaca        u     u uuuuuuu   - u         g           ua    uaucucuacgucuacgaggagaucgagaagagagaaaaaaaaaaaagugcuaaguguag 
Get sequence
Deep sequencing
226 reads, 7.6e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 24813775-24814030 [-]
intergenic
Database links

Mature sequence aly-miR157d-5p

Accession MIMAT0017419
Previous IDsaly-miR157d
Sequence

38 - 

ugacagaagauagagagcac

 - 57

Get sequence
Deep sequencing215 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR157d-3p

Accession MIMAT0017420
Previous IDsaly-miR157d*
Sequence

193 - 

gcucucuaugcuucugucauc

 - 213

Get sequence
Deep sequencing9 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2