Stem-loop sequence aly-MIR159b

AccessionMI0014516 (change log)
DescriptionArabidopsis lyrata miR159b stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
      a a   a  g            ga       u       uu   ------    ua    -      g  a  c      uc       ----      caaa 
5' gga g aga ga gaagagcuccuu  aguucaa ggagggu  agc      aggg  aagu aaagcu cu ag uaugga  ccauaaa    ccuuau    u
   ||| | ||| || ||||||||||||  ||||||| |||||||  |||      ||||  |||| |||||| || || ||||||  |||||||    ||||||     
3' ccu c ucu cu cuucucgaggga  uuagguu cuucuca  ucg      uccc  uuca uuucga ga uc auaccu  gguauuu    ggaaua    u
      c a   -  a            ag       u       cu   guaauu    ca    c      g  c  u      ua       uuua      aaac 
Get sequence
Deep sequencing
8400 reads, 2.88e+05 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 7594092-7594293 [+]
intergenic
Database links

Mature sequence aly-miR159b-5p

Accession MIMAT0017425
Previous IDsaly-miR159b*
Sequence

17 - 

gagcuccuugaaguucaaugg

 - 37

Get sequence
Deep sequencing222 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR159b-3p

Accession MIMAT0017426
Previous IDsaly-miR159b
Sequence

169 - 

uuuggauugaagggagcucuu

 - 189

Get sequence
Deep sequencing8133 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2