Stem-loop sequence aly-MIR319b

AccessionMI0014519 (change log)
DescriptionArabidopsis lyrata miR319b stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
        uuaau   -  uaua   guu   uu        a  a     uu          cu       uaauau    -         -ga      ac        c  aa     a    aa   c 
5' aaaug     aug gu    gau   gag  ggugaagg ag gagcu  cuucggucca  cauggag      guga gauuuaauu   cucucg  ucauucau ca  uacca auga  gaa a
   |||||     ||| ||    |||   |||  |||||||| || |||||  ||||||||||  |||||||      |||| |||||||||   ||||||  |||||||| ||  ||||| ||||  |||  
3' uuuac     uac ca    cug   cuu  uuauuuuu uc cucga  gaagucaggu  guaucuc      cacu cugaguuaa   gagagc  aguaagua gu  auggu uacu  cuu u
        ---uu   a  --ug   gcu   uu        a  c     gg          uc       ----uu    u         aca      gu        a  aa     a    --   g 
Get sequence
Deep sequencing
19 reads, 400 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 21388787-21389032 [+]
intergenic
Database links

Mature sequence aly-miR319b-5p

Accession MIMAT0017431
Previous IDsaly-miR319b*
Sequence

42 - 

agagcuuucuucgguccacuc

 - 62

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR319b-3p

Accession MIMAT0017432
Previous IDsaly-miR319b
Sequence

191 - 

uuggacugaagggagcucccu

 - 211

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2