Stem-loop sequence aly-MIR319c

AccessionMI0014520 (change log)
DescriptionArabidopsis lyrata miR319c stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
   auag       uaug   c    uu     a  --------    uau        a              u        gaaa      a gg           g   ac    c   c  aa    c     ag    acg 
5'     auaaaua    aau gaga  aaaau ga        uaga   agaaggag uucuuucaguccag cauggaua    aagaag g  uagaaauaucu ccg  ucau cau ca  cacu guggu  agaa   a
       |||||||    ||| ||||  ||||| ||        ||||   |||||||| |||||||||||||| ||||||||    |||||| |  ||||||||||| |||  |||| ||| ||  |||| |||||  ||||    
3'     uauuugu    uua cucu  uuuua cu        aucu   ucuuccuc agggaagucagguu gugucuau    uucuuc c  guuuuuauaga ggc  agua gua gu  guga cgcca  uuuu   u
   uaua       -cca   -    uu     -  uuuuuaac    uuu        g              u        ----      - ua           g   gu    a   u  ca    -     aa    aac 
Get sequence
Deep sequencing
2134 reads, 7.41e+04 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 19899133-19899403 [+]
intergenic
Database links

Mature sequence aly-miR319c-5p

Accession MIMAT0017433
Previous IDsaly-miR319c*
Sequence

45 - 

ggagauucuuucaguccaguc

 - 65

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR319c-3p

Accession MIMAT0017434
Previous IDsaly-miR319c
Sequence

204 - 

uuggacugaagggagcuccuu

 - 224

Get sequence
Deep sequencing2133 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2