Stem-loop sequence aly-MIR160b

AccessionMI0014522 (change log)
DescriptionArabidopsis lyrata miR160b stem-loop
Gene family MIPF0000032; MIR160
Stem-loop
          --   --uuuaa        c     c -           a  aaaac        ag 
5' uauauau  aga       ggucgugc uggcu c cuguaugccac ag     aucgauuu  u
   |||||||  |||       |||||||| ||||| | ||||||||||| ||     ||||||||  u
3' auauaua  ucu       ccaguacg acuga g gacaugcggug uc     uagcuaaa  a
          gu   uucgaaa        a     u a           a  ---ac        ac 
Get sequence
Deep sequencing
153 reads, 4.7e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 11280816-11280940 [-]
intergenic
Database links

Mature sequence aly-miR160b-5p

Accession MIMAT0017437
Previous IDsaly-miR160b
Sequence

21 - 

ugccuggcucccuguaugcca

 - 41

Get sequence
Deep sequencing153 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR160b-3p

Accession MIMAT0017438
Previous IDsaly-miR160b*
Sequence

82 - 

gcguacagaguagucaagcaug

 - 103

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2