Stem-loop sequence aly-MIR161

AccessionMI0014524 (change log)
DescriptionArabidopsis lyrata miR161 stem-loop
Gene family MIPF0000455; MIR161
Stem-loop
      c      u            c         --   u     ug  gc   -  cg      
5' gau aaugca ugaaagugacua aucgggguu  uug uuuuu  uu  ucc ca  aucga 
   ||| |||||| |||||||||||| |||||||||  ||| |||||  ||  ||| ||  |||| a
3' cua uuacgu acuuucacugau uggccccaa  aau aaaaa  ag  agg gu  uagcu 
      a      c            u         cu   u     gu  -a   a  -a      
Get sequence
Deep sequencing
381 reads, 1.2e+04 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 24491110-24491231 [+]
intergenic
Database links

Mature sequence aly-miR161-5p.2

Accession MIMAT0017441
Previous IDsaly-miR161.2
Sequence

3 - 

ucaaugcauugaaagugacua

 - 23

Get sequence
Deep sequencing375 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR161-5p.1

Accession MIMAT0017442
Previous IDsaly-miR161.1
Sequence

11 - 

uugaaagugacuacaucgggg

 - 31

Get sequence
Deep sequencing378 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR161-3p.1

Accession MIMAT0017443
Previous IDsaly-miR161.1*
Sequence

94 - 

ccgguuuagucacuuucac

 - 112

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR161-3p.2

Accession MIMAT0017444
Previous IDsaly-miR161.2*
Sequence

102 - 

gucacuuucacugcauuaauc

 - 122

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2