Stem-loop sequence aly-MIR162a

AccessionMI0014525 (change log)
DescriptionArabidopsis lyrata miR162a stem-loop
Gene family MIPF0000127; MIR162_1
Stem-loop
        -gggaaa      --g    -uuu    uuuuuu        ---uaguu   a      u ag  u       g    c    c        c   c  -ggaacg     a 
5' gauuc       uuuuau   uuuc    gcca      uuggaguu        gga aaagag g  ag cgcugga gcag gguu aucgaucu uuc ug       aauau u
   |||||       ||||||   ||||    ||||      ||||||||        ||| |||||| |  || ||||||| |||| |||| |||||||| ||| ||       |||||  
3' cugag       ggagug   aaag    uggu      aacuucgg        ucu uuucuc c  uu gcgaccu cguc ccaa uagcuaga aag ac       uuaua a
        acaaaag      aaa    uuuu    uuuuuu        uuauuguu   a      - gu  -       a    u    a        u   u  gaaaaag     a 
Get sequence
Deep sequencing
106 reads, 3e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 3221153-3221380 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR162a
aly-MIR834GL348718.1: 3227917-3228096 [-]
aly-MIR162aGL348718.1: 3221153-3221380 [-]
Database links

Mature sequence aly-miR162a-5p

Accession MIMAT0017445
Previous IDsaly-miR162a*
Sequence

70 - 

ggaggcagcgguucaucgauc

 - 90

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR162a-3p

Accession MIMAT0017446
Previous IDsaly-miR162a
Sequence

136 - 

ucgauaaaccucugcauccag

 - 156

Get sequence
Deep sequencing106 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2