Stem-loop sequence aly-MIR162b

AccessionMI0014526 (change log)
DescriptionArabidopsis lyrata miR162b stem-loop
Gene family MIPF0000127; MIR162_1
Stem-loop
         u   uc    cucauuu    -guu     ---uu       a u       g    c    c       a    c   gaauau     u 
5' uuuuuu agu  ucuc       uuau    uggau     agaguga g cgcugga gcag gguu aucgauc auuc ugu      uuuug u
   |||||| |||  ||||       ||||    |||||     ||||||| | ||||||| |||| |||| ||||||| |||| |||      |||||  
3' agaaaa ucg  agag       aaua    gucua     ucucauu c gcgaccu cguc ccaa uagcuag uaag acg      aaaac u
         c   ua    uuuaucu    auuu     cuccu       - -       a    u    a       c    u   ------     u 
Get sequence
Deep sequencing
106 reads, 3e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 9808781-9808964 [-]
intergenic
Database links

Mature sequence aly-miR162b-5p

Accession MIMAT0017447
Previous IDsaly-miR162b*
Sequence

52 - 

ggaggcagcgguucaucgauc

 - 72

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR162b-3p

Accession MIMAT0017448
Previous IDsaly-miR162b
Sequence

113 - 

ucgauaaaccucugcauccag

 - 133

Get sequence
Deep sequencing106 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2