Stem-loop sequence aly-MIR164a

AccessionMI0014527 (change log)
DescriptionArabidopsis lyrata miR164a stem-loop
Gene family MIPF0000045; MIR164
Stem-loop
             ca   c         c  acaaac   a 
5' guuggagaag  ggg acgugcaaa ca      acg a
   ||||||||||  ||| ||||||||| ||      ||| a
3' caaccucuuc  cuc ugcacguuu gu      ugc u
             cc   a         u  guacuc   c 
Get sequence
Deep sequencing
170 reads, 5.1e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 23120175-23120253 [+]
intergenic
Database links

Mature sequence aly-miR164a-5p

Accession MIMAT0017449
Previous IDsaly-miR164a
Sequence

3 - 

uggagaagcagggcacgugca

 - 23

Get sequence
Deep sequencing170 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR164a-3p

Accession MIMAT0017450
Previous IDsaly-miR164a*
Sequence

59 - 

cacguacuccccuucuccaac

 - 79

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2