Stem-loop sequence aly-MIR165a

AccessionMI0014530 (change log)
DescriptionArabidopsis lyrata miR165a stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
       u   aauuaa  u  uu  -    a    a   uu      a           auacauaua         au 
5' auca gag      gc au  ca guug gggg aug  gucugg ucgaggauauu         uacaugugu  g
   |||| |||      || ||  || |||| |||| |||  |||||| |||||||||||         |||||||||   
3' uagu cuc      cg ua  gu caac cccc uac  cggacc ggcuccuauga         guguacaua  u
       -   ------  u  uu  a    c    c   uu      a           gagauacua         gu 
Get sequence
Deep sequencing
123 reads, 3.9e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 449074-449221 [+]
intergenic
Database links

Mature sequence aly-miR165a-5p

Accession MIMAT0017455
Previous IDsaly-miR165a*
Sequence

32 - 

gaauguugucuggaucgagg

 - 51

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR165a-3p

Accession MIMAT0017456
Previous IDsaly-miR165a
Sequence

106 - 

ucggaccaggcuucaucccc

 - 125

Get sequence
Deep sequencing113 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2