Stem-loop sequence aly-MIR166b

AccessionMI0014533 (change log)
DescriptionArabidopsis lyrata miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

1 open access papers mention aly-MIR166b
(2 sentences)

Stem-loop
          uuuuucuu   a     c  uu      cu      -  cuu        a     -   uu  aaua 
5' agaggga        uug gggga ug  gucugg  cgaggu cu   auucuaau caauc uca  uc    g
   |||||||        ||| ||||| ||  ||||||  |||||| ||   |||||||| ||||| |||  ||     
3' ucucccu        aac ccccu ac  cggacc  gcucua ga   ugggauua guuag agu  ag    u
          -cauuauu   c     u  uu      ag      c  uuu        -     u   cu  acuc 
Get sequence
Deep sequencing
149 reads, 4.5e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 20552770-20552917 [+]
intergenic
Database links

Mature sequence aly-miR166b-5p

Accession MIMAT0017461
Previous IDsaly-miR166b*
Sequence

22 - 

ggacuguugucuggcucgagg

 - 42

Get sequence
Deep sequencing17 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR166b-3p

Accession MIMAT0017462
Previous IDsaly-miR166b
Sequence

110 - 

ucggaccaggcuucauucccc

 - 130

Get sequence
Deep sequencing132 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2