Stem-loop sequence aly-MIR166d

AccessionMI0014535 (change log)
DescriptionArabidopsis lyrata miR166d stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
        a a      uu      cu     -    ga  aagaucauuagauugauu 
5' gguug g ggaaug  gucugg  cgagg ucau  ag                  c
   ||||| | ||||||  ||||||  ||||| ||||  ||                   
3' ccaac c ccuuac  cggacc  gcucu agua  uc                  a
        c c      uu      ag     u    aa  ccaaaaguaagaaauucu 
Get sequence
Deep sequencing
154 reads, 4.4e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 3632178-3632290 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR166d
aly-MIR166cGL348718.1: 3626989-3627109 [+]
aly-MIR166dGL348718.1: 3632178-3632290 [+]
Database links

Mature sequence aly-miR166d-5p

Accession MIMAT0017465
Previous IDsaly-miR166d*
Sequence

9 - 

ggaauguugucuggcucgagg

 - 29

Get sequence
Deep sequencing22 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR166d-3p

Accession MIMAT0017466
Previous IDsaly-miR166d
Sequence

87 - 

ucggaccaggcuucauucccc

 - 107

Get sequence
Deep sequencing132 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2