Stem-loop sequence aly-MIR166e

AccessionMI0014536 (change log)
DescriptionArabidopsis lyrata miR166e stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
      u   u uucu  agu     uuuuucuu            uu      ca   g c c      ---u     uauauuugauuuuaugucucuucuuua 
5' gag cca g    uc   gaagc        uugaggggaaug  gucugg  cga g c uuaacu    agauc                           u
   ||| ||| |    ||   |||||        ||||||||||||  ||||||  ||| | | ||||||    |||||                            
3' uuc ggu c    ag   cuucg        aacuccccuuac  cggacc  gcu c g aauugg    uuuag                           u
      -   u ---u  cuu     -cuauauu            uu      ag   g a u      caau     cuaguaaguacauauauaucugauuau 
Get sequence
Deep sequencing
152 reads, 4.5e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 21195577-21195776 [+]
intergenic
Database links

Mature sequence aly-miR166e-5p

Accession MIMAT0017467
Previous IDsaly-miR166e*
Sequence

38 - 

ggaauguugucuggcacgagg

 - 58

Get sequence
Deep sequencing18 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR166e-3p

Accession MIMAT0017468
Previous IDsaly-miR166e
Sequence

150 - 

ucggaccaggcuucauucccc

 - 170

Get sequence
Deep sequencing134 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2