Stem-loop sequence aly-MIR166g

AccessionMI0014538 (change log)
DescriptionArabidopsis lyrata miR166g stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
   -ggaa     --uua     u  a      uu      cu     -    gg     aauuc   a 
5'      gcgau     ggguu ag ggaaug  guuugg  cgagg ucau  agagu     guu c
        |||||     ||||| || ||||||  ||||||  ||||| ||||  |||||     ||| c
3'      cgcua     uccaa uc ccuuac  cggacc  gcucu agua  ucuca     caa a
   uuuua     uuuua     c  c      uu      ag     u    aa     aaaca   a 
Get sequence
Deep sequencing
146 reads, 4.4e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 21095446-21095576 [+]
intergenic
Database links

Mature sequence aly-miR166g-5p

Accession MIMAT0017471
Previous IDsaly-miR166g*
Sequence

22 - 

ggaauguuguuuggcucgagg

 - 42

Get sequence
Deep sequencing9 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR166g-3p

Accession MIMAT0017472
Previous IDsaly-miR166g
Sequence

89 - 

ucggaccaggcuucauucccc

 - 109

Get sequence
Deep sequencing137 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2