Stem-loop sequence aly-MIR167a

AccessionMI0014539 (change log)
DescriptionArabidopsis lyrata miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Stem-loop
        ac   -  u u a         c              -  -   -     a  u             
5' ggugc  cgg ca c g ugaagcugc agcaugaucuaauu ag cuu ucuuu ua cuguuguugugu 
   |||||  ||| || | | ||||||||| |||||||||||||| || ||| ||||| || ||||||||||| u
3' ccacg  guc gu g c acuuugacg uuguacuagauuag uc gag agaga au gguagcaauacu 
        cu   a  u c c         c              c  u   u     -  u             
Get sequence
Deep sequencing
3749 reads, 1.28e+05 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 10278871-10279008 [+]
intergenic
Database links

Mature sequence aly-miR167a-5p

Accession MIMAT0017473
Previous IDsaly-miR167a
Sequence

18 - 

ugaagcugccagcaugaucua

 - 38

Get sequence
Deep sequencing3700 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR167a-3p

Accession MIMAT0017474
Previous IDsaly-miR167a*
Sequence

102 - 

gaucauguucgcaguuucacc

 - 122

Get sequence
Deep sequencing49 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2