Stem-loop sequence aly-MIR168b

AccessionMI0014544 (change log)
DescriptionArabidopsis lyrata miR168b stem-loop
Gene family MIPF0000081; MIR168
Stem-loop
   -----a     aaauacgaug    aaag     gg   u   g      c          u     ----  u        --      u  a 
5'       gagag          auuu    uuacc  cgg cuc gauucg uuggugcagg cggga    ac gauuagcu  gacaau ac c
         |||||          ||||    |||||  ||| ||| |||||| |||||||||| |||||    || ||||||||  |||||| ||  
3'       cuuuc          uaaa    agugg  gcc gag cuaagu aacuauguuc gcccu    ug uugguugg  cuguug ug g
   ucuaga     auucuaggaa    -aaa     -a   u   g      c          u     agag  u        ua      -  u 
Get sequence
Deep sequencing
354 reads, 1.1e+04 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 2067187-2067362 [+]
intergenic
Database links

Mature sequence aly-miR168b-5p

Accession MIMAT0017483
Previous IDsaly-miR168b
Sequence

43 - 

ucgcuuggugcaggucgggaa

 - 63

Get sequence
Deep sequencing346 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR168b-3p

Accession MIMAT0017484
Previous IDsaly-miR168b*
Sequence

113 - 

cccgucuuguaucaacugaau

 - 133

Get sequence
Deep sequencing8 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2