Stem-loop sequence aly-MIR169d

AccessionMI0014548 (change log)
DescriptionArabidopsis lyrata miR169d stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
         uu    c u    g     aau      u     u         a          auuuu     aca    uu 
5' guaucu  gagu u acau gaaaa   agagaa gagau gagccaagg ugacuugccg     uauca   aauc  a
   ||||||  |||| | |||| |||||   |||||| ||||| ||||||||| ||||||||||     |||||   ||||   
3' uauaga  cuca a ugua cuuuu   ucucuu cuuug cucgguucc guugaacggc     guggu   uuag  a
         -u    a c    g     -cu      c     u         a          ---cc     --a    uc 
Get sequence
Deep sequencing
92 reads, 2.7e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 28725944-28726098 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR169d
aly-MIR169eGL348713.1: 28728962-28729135 [+]
aly-MIR169dGL348713.1: 28725944-28726098 [-]
Database links

Mature sequence aly-miR169d-5p

Accession MIMAT0017491
Previous IDsaly-miR169d
Sequence

41 - 

ugagccaaggaugacuugccg

 - 61

Get sequence
Deep sequencing74 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR169d-3p

Accession MIMAT0017492
Previous IDsaly-miR169d*
Sequence

99 - 

gcaaguugaccuuggcucugu

 - 119

Get sequence
Deep sequencing17 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2