Stem-loop sequence aly-MIR169f

AccessionMI0014550 (change log)
DescriptionArabidopsis lyrata miR169f stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
         a a      u     a       a        auu         a           uuuaa    aaccggauuaugaccauugauuu 
5' uguauc g gggucu gcaug aggaaua agaaugga   gagccaagg ugacuugccgg     acac                       g
   |||||| | |||||| ||||| ||||||| ||||||||   ||||||||| |||||||||||     ||||                        
3' auauag c cuuaga uguac uucuuau ucuugcuu   cucgguucc guugaacgguc     ugug                       g
         a -      u     c       c        cgu         a           -----    cuuaguugucuaacacuuacucu 
Get sequence
Deep sequencing
95 reads, 2.8e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 6024138-6024321 [-]
intergenic
Database links

Mature sequence aly-miR169f-5p

Accession MIMAT0017495
Previous IDsaly-miR169f
Sequence

41 - 

ugagccaaggaugacuugccg

 - 61

Get sequence
Deep sequencing78 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR169f-3p

Accession MIMAT0017496
Previous IDsaly-miR169f*
Sequence

127 - 

gcaaguugaccuuggcucugc

 - 147

Get sequence
Deep sequencing17 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2