Stem-loop sequence aly-MIR169g

AccessionMI0014551 (change log)
DescriptionArabidopsis lyrata miR169g stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
                 ucuc   --u      -a a      u    g      u      u    uu         a            uuuuu     au     uu 
5' augaugaugaugag    uag   uguauc  g gggucu gcau gaagag agagaa gagg  gagccaagg ugacuugccggg     uacca  gaauc  a
   ||||||||||||||    |||   ||||||  | |||||| |||| |||||| |||||| ||||  ||||||||| ||||||||||||     |||||  |||||   
3' uacugcuacuacuu    auc   auauag  c cucaga ugua cuuuuc ucucuu cuuu  cucgguucc guugaacggccu     guggu  uuuag  a
                 ---u   uau      cg -      c    g      u      c    gu         a            -----     --     uc 
Get sequence
Deep sequencing
94 reads, 2.8e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 9192991-9193192 [+]
intergenic
Database links

Mature sequence aly-miR169g-5p

Accession MIMAT0017497
Previous IDsaly-miR169g
Sequence

63 - 

ugagccaaggaugacuugccg

 - 83

Get sequence
Deep sequencing76 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR169g-3p

Accession MIMAT0017498
Previous IDsaly-miR169g*
Sequence

123 - 

gcaaguugaccuuggcucugu

 - 143

Get sequence
Deep sequencing17 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2