Stem-loop sequence aly-MIR169i

AccessionMI0014553 (change log)
DescriptionArabidopsis lyrata miR169i stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
        -a      aa       -u       u     uu  -uag       u    u       uc    -----gc            gugucauguuugacaaagu 
5' gaagg  gauguc  agaugag  aggagaa cauau  gg    ccaagga gacu gccugau  cuuu       guaaaaugguua                   g
   |||||  ||||||  |||||||  ||||||| |||||  ||    ||||||| |||| |||||||  ||||       ||||||||||||                   a
3' cuucu  uuacag  ucuacuu  ucuucuu guaua  cc    gguuccu cuga cggacug  gaaa       cguuuuaccagu                   c
        ac      ac       uc       -     uu  uaua       -    -       ua    aaauauu            agcgaacuacauuaacuau 
Get sequence
Deep sequencing
34 reads, 900 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 3130574-3130783 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR169i
aly-MIR169jGL348717.1: 3130897-3131196 [-]
aly-MIR169iGL348717.1: 3130574-3130783 [-]
Database links

Mature sequence aly-miR169i-5p

Accession MIMAT0017501
Previous IDsaly-miR169i
Sequence

40 - 

uagccaaggaugacuugccug

 - 60

Get sequence
Deep sequencing32 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR169i-3p

Accession MIMAT0017502
Previous IDsaly-miR169i*
Sequence

153 - 

ggcagucuccuuggauauc

 - 171

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2