Stem-loop sequence aly-MIR169j

AccessionMI0014554 (change log)
DescriptionArabidopsis lyrata miR169j stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
      u     aaaac   u   g aa     ugu   au        g    c        -c        u      -ua           u    u      -u   uuuc    c           u   aguucaugcguuuuggauuauuaug 
5' gaa gaggc     aua uga u  uggag   aua  gaggaaga aggu uaacaugg  gaaaagag cauguu   auagccaagga gacu gccuga  cuu    accu caugauucaau uga                         c
   ||| |||||     ||| ||| |  |||||   |||  |||||||| |||| ||||||||  |||||||| ||||||   ||||||||||| |||| ||||||  |||    |||| ||||||||||| |||                          
3' cuu cucug     uau acu a  aucuc   ugu  uucuuuuu ucca auuguacc  cuuuuuuc guacag   uaucgguuccu cuga cggacu  gga    uggg guacuaaguug acu                         a
      -     --aau   c   g -a     ---   cu        g    u        ua        -      uuc           -    -      uu   ---u    c           u   aaaagcuuaauaauauggaaaaucu 
Get sequence
Deep sequencing
38 reads, 900 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 3130897-3131196 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR169j
aly-MIR169jGL348717.1: 3130897-3131196 [-]
aly-MIR169iGL348717.1: 3130574-3130783 [-]
Database links

Mature sequence aly-miR169j-5p

Accession MIMAT0017503
Previous IDsaly-miR169j
Sequence

80 - 

uagccaaggaugacuugccug

 - 100

Get sequence
Deep sequencing32 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR169j-3p

Accession MIMAT0017504
Previous IDsaly-miR169j*
Sequence

211 - 

ggcagucuccuuggcuauc

 - 229

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2