Stem-loop sequence aly-MIR169k

AccessionMI0014555 (change log)
DescriptionArabidopsis lyrata miR169k stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
        -       aa      au    -    cacauuu            u    u     -uu     gaacaaaau   -u        g           u 
5' gaagg agauguc  agauga  aaga gaac       gguagccaagga gacu gccug   ucuuu         ggu  ggugucau uuugaugugac a
   ||||| |||||||  ||||||  |||| ||||       |||||||||||| |||| |||||   |||||         |||  |||||||| ||||||||||| c
3' cuucc uuuacag  ucuacu  uucu cuug       cuaucgguuccu cuga cggac   agaaa         ucg  uuacagua gaacuauauug a
        a       ac      cu    u    uauauuc            -    -     uac     ----aauau   uu        a           a 
Get sequence
Deep sequencing
34 reads, 900 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 3143745-3143947 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR169k
aly-MIR169nGL348717.1: 3151664-3151915 [-]
aly-MIR169mGL348717.1: 3151345-3151574 [-]
aly-MIR169lGL348717.1: 3149048-3149319 [-]
aly-MIR169kGL348717.1: 3143745-3143947 [-]
Database links

Mature sequence aly-miR169k-5p

Accession MIMAT0017505
Previous IDsaly-miR169k
Sequence

40 - 

uagccaaggaugacuugccug

 - 60

Get sequence
Deep sequencing31 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR169k-3p

Accession MIMAT0017506
Previous IDsaly-miR169k*
Sequence

146 - 

ggcagucuccuuggcuauc

 - 164

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2