Stem-loop sequence aly-MIR169m

AccessionMI0014557 (change log)
DescriptionArabidopsis lyrata miR169m stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
   ---ucauuauuua     -a      aa      -         u     uu  -          u    u    -  u    ----              auugucauguuugacaagug 
5'              gaagg  aauguc  agauga auaggagaa cauau  gg uagccaagga gacu gccu gu ucuu    ugaguaaaaugguu                    a
                |||||  ||||||  |||||| ||||||||| |||||  || |||||||||| |||| |||| || ||||    ||||||||||||||                     
3'              cuucc  uugcag  ucuacu ugucuucuu guaua  cc aucgguucuu cuga cgga ua agaa    acucauuuuaccag                    c
   agaauaaaaucua     aa      ac      c         -     uu  u          -    -    g  c    aacu              caaugaacuauauugaauau 
Get sequence
Deep sequencing
32 reads, 900 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 3151345-3151574 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR169m
aly-MIR169nGL348717.1: 3151664-3151915 [-]
aly-MIR169mGL348717.1: 3151345-3151574 [-]
aly-MIR169lGL348717.1: 3149048-3149319 [-]
aly-MIR169kGL348717.1: 3143745-3143947 [-]
Database links

Mature sequence aly-miR169m-5p

Accession MIMAT0017509
Previous IDsaly-miR169m
Sequence

50 - 

uagccaaggaugacuugccug

 - 70

Get sequence
Deep sequencing31 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR169m-3p

Accession MIMAT0017510
Previous IDsaly-miR169m*
Sequence

160 - 

ggcagucuucuuggcuauc

 - 178

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2