Stem-loop sequence aly-MIR170

AccessionMI0014559 (change log)
DescriptionArabidopsis lyrata miR170 stem-loop
Gene family MIPF0000030; MIR171_1
Stem-loop
   cauuc  ucucuu      u   uucucu           -  cc     -ucuc    ------uc        uc cucu         c       c      ucuccu 
5'      uc      cgauuc ugu      ugcaaaacaga ua  cucug     ugag        cgagagag  c    gauauuggc ugguuca ucagau      a
        ||      |||||| |||      ||||||||||| ||  |||||     ||||        ||||||||  |    ||||||||| ||||||| ||||||      a
3'      ag      guugag aca      auguuuuguuu gu  gagau     acuc        gcucucuc  g    cuauaacug gccgagu agucua      c
   -guau  uuguuu      c   -----c           u  ua     uucau    ucuucgcu        cu -acu         u       u      cucaau 
Get sequence
Deep sequencing
25 reads, 800 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 22899701-22899912 [+]
intergenic
Database links

Mature sequence aly-miR170-5p

Accession MIMAT0017513
Previous IDsaly-miR170*
Sequence

77 - 

uauuggccugguucacucaga

 - 97

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR170-3p

Accession MIMAT0017514
Previous IDsaly-miR170
Sequence

117 - 

ugauugagccgugucaauauc

 - 137

Get sequence
Deep sequencing21 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2