Stem-loop sequence aly-MIR171a

AccessionMI0014560 (change log)
DescriptionArabidopsis lyrata miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Stem-loop
      uuu      uu   uuccuuu a    ucacuua  c          cc  uu         c       c      cu  ccugaccacacucacguc 
5' ucg   uuuaua  guu       g ucua       ag acgagagagu  cu  gauauuggc ugguuca ucagau  uc                  g
   |||   ||||||  |||       | ||||       || ||||||||||  ||  ||||||||| ||||||| ||||||  ||                   
3' agc   aaaugu  uag       c aggu       uc ugcucucuca  ga  cuauaaccg gccgagu agucua  ag                  u
      --u      uc   --uguuu -    -uuuauc  -          -u  cu         c       u      uu  aucucucuuacguauaca 
Get sequence
Deep sequencing
96 reads, 2.9e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 15611064-15611261 [+]
intergenic
Database links

Mature sequence aly-miR171a-5p

Accession MIMAT0017515
Previous IDsaly-miR171a*
Sequence

59 - 

uauuggccugguucacucaga

 - 79

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR171a-3p

Accession MIMAT0017516
Previous IDsaly-miR171a
Sequence

130 - 

ugauugagccgcgccaauauc

 - 150

Get sequence
Deep sequencing92 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2