Stem-loop sequence aly-MIR171c

AccessionMI0014562 (change log)
DescriptionArabidopsis lyrata miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Stem-loop
   --ggacauc       a        ug             -      uac     ug 
5'          gaauacg gauauugg  cgguucaaucaga aaacug   ucuuu  u
            ||||||| ||||||||  ||||||||||||| ||||||   |||||   
3'          uuugugc cuauaacc  gccgaguuaguuu uuuggc   agaaa  u
   uuugauaaa       a        gu             g      --u     uu 
Get sequence
Deep sequencing
156 reads, 4.8e+03 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 1951192-1951302 [+]
intergenic
Database links

Mature sequence aly-miR171c-5p

Accession MIMAT0017519
Previous IDsaly-miR171c*
Sequence

15 - 

agauauuggugcgguucaauc

 - 35

Get sequence
Deep sequencing45 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR171c-3p

Accession MIMAT0017520
Previous IDsaly-miR171c
Sequence

77 - 

uugagccgugccaauaucacg

 - 97

Get sequence
Deep sequencing111 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2