Stem-loop sequence aly-MIR172a

AccessionMI0014563 (change log)
DescriptionArabidopsis lyrata miR172a stem-loop
Gene family MIPF0000035; MIR172
Stem-loop
       -------ccac     c  u      c  ug               a   --cuguu  u    gg   u  uu 
5' ggag           ggucg ug uugcug ug  gcaucaucaagauuc cau       ga ggac  ugg ga  c
   ||||           ||||| || |||||| ||  ||||||||||||||| |||       || ||||  ||| ||  g
3' ccuc           ucggc ac aacggc ac  cguaguaguucuaag gua       cu cuug  acc cu  c
       ucuuuuucuua     a  u      u  gu               a   aaaguau  -    aa   c  cu 
Get sequence
Deep sequencing
3502 reads, 1.19e+05 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 12144107-12144255 [+]
intergenic
Database links

Mature sequence aly-miR172a-5p

Accession MIMAT0017521
Previous IDsaly-miR172a*
Sequence

26 - 

guggcaucaucaagauucaca

 - 46

Get sequence
Deep sequencing23 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR172a-3p

Accession MIMAT0017522
Previous IDsaly-miR172a
Sequence

99 - 

agaaucuugaugaugcugcau

 - 119

Get sequence
Deep sequencing3478 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2