Stem-loop sequence aly-MIR172c

AccessionMI0014565 (change log)
DescriptionArabidopsis lyrata miR172c stem-loop
Gene family MIPF0000035; MIR172
Stem-loop
           uuc  u    g                a  --a  -      --    ucg        a 
5' agcuacug   gc guug agcaucaucaagauuc ca   au caucaa  guau   uguaaaug a
   ||||||||   || |||| |||||||||||||||| ||   || ||||||  ||||   ||||||||  
3' ucggugac   cg cgac ucguaguaguucuaag gu   ua guaguu  uaua   auauuuac c
           uaa  u    g                a  aug  u      gu    uua        c 
Get sequence
Deep sequencing
3396 reads, 1.17e+05 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 4586846-4586978 [-]
intergenic
Database links

Mature sequence aly-miR172c-5p

Accession MIMAT0017525
Previous IDsaly-miR172c*
Sequence

18 - 

ggagcaucaucaagauucaca

 - 38

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR172c-3p

Accession MIMAT0017526
Previous IDsaly-miR172c
Sequence

98 - 

agaaucuugaugaugcugcag

 - 118

Get sequence
Deep sequencing3395 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2