Stem-loop sequence aly-MIR172d

AccessionMI0014566 (change log)
DescriptionArabidopsis lyrata miR172d stem-loop
Gene family MIPF0000035; MIR172
Stem-loop
   gauucagaauuugaaguuaguggca      -gu    ua     a    u         ag         ucuuu         uc 
5'                          gucauu   uugc  uugca cauc ucaagauuc  aaaucagau     uauggguuu  u
                            ||||||   ||||  ||||| |||| |||||||||  |||||||||     |||||||||   
3'                          cgguaa   aacg  gacgu guag aguucuaag  uuugguuua     auauccgag  u
   ---------uugggaucuauuuauu      auu    gc     c    u         ag         ---uu         uu 
Get sequence
Deep sequencing
3394 reads, 1.17e+05 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 17548801-17548963 [+]
intergenic
Database links

Mature sequence aly-miR172d-5p

Accession MIMAT0017527
Previous IDsaly-miR172d*
Sequence

42 - 

gcaacaucuucaagauucaga

 - 62

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR172d-3p

Accession MIMAT0017528
Previous IDsaly-miR172d
Sequence

112 - 

agaaucuugaugaugcugcag

 - 132

Get sequence
Deep sequencing3394 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2