Stem-loop sequence aly-MIR390a

AccessionMI0014569 (change log)
DescriptionArabidopsis lyrata miR390a stem-loop
Gene family MIPF0000101; MIR390
Stem-loop
   ccaaaaaacaa    --      au u  a          g           ugau    uuauu 
5'            guag  agaaga  c gu aagcucagga ggauagcgcca    gauc     u
              ||||  ||||||  | || |||||||||| |||||||||||    ||||      
3'            cauc  ucuucu  g ua uuugaguccu ccuaucgcggu    uuag     c
   ggaaaauguaa    au      cg u  c          a           -uuu    cuaua 
Get sequence
Deep sequencing
16 reads, 300 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 18611034-18611162 [+]
intergenic
Database links

Mature sequence aly-miR390a-5p

Accession MIMAT0017533
Previous IDsaly-miR390a
Sequence

29 - 

aagcucaggagggauagcgcc

 - 49

Get sequence
Deep sequencing13 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR390a-3p

Accession MIMAT0017534
Previous IDsaly-miR390a*
Sequence

81 - 

cgcuauccauccugaguuuca

 - 101

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2