Stem-loop sequence aly-MIR390b

AccessionMI0014570 (change log)
DescriptionArabidopsis lyrata miR390b stem-loop
Gene family MIPF0000101; MIR390
Stem-loop
       -   aaau      aa         g           ugaau  ccaa   -    g  uuu 
5' agua gaa    agcuau  agcucagga ggauagcgcca     ca    uac ugua gu   g
   |||| |||    ||||||  ||||||||| |||||||||||     ||    ||| |||| ||   u
3' ucgu cuu    ucgaua  uugaguccu ccuaucgcggu     gu    aug acgu ca   a
       u   --cu      cc         a           ----u  cuag   u    a  uau 
Get sequence
Deep sequencing
12 reads, 200 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 18617960-18618086 [+]
intergenic
Database links

Mature sequence aly-miR390b-5p

Accession MIMAT0017535
Previous IDsaly-miR390b
Sequence

19 - 

aagcucaggagggauagcgcc

 - 39

Get sequence
Deep sequencing12 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR390b-3p

Accession MIMAT0017536
Previous IDsaly-miR390b*
Sequence

92 - 

cgcuauccauccugaguucca

 - 112

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2