Stem-loop sequence aly-MIR391

AccessionMI0014571 (change log)
DescriptionArabidopsis lyrata miR391 stem-loop
Gene family MIPF0001151; MIR391
Stem-loop
      -aaca   au     u  c          g  c      -----cu      
5' gca     aag  uugcu cg aggagagaua cg caccac       cuucu 
   |||     |||  ||||| || |||||||||| || ||||||       |||| a
3' cgu     uuc  aacga gc uccucucuau gc guggug       gaaga 
      auaua   cu     u  a          g  a      accaauu      
Get sequence
Deep sequencing
263 reads, 7.3e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 19524569-19524671 [+]
intergenic
Database links

Mature sequence aly-miR391-5p

Accession MIMAT0017537
Previous IDsaly-miR391
Sequence

17 - 

uucgcaggagagauagcgcca

 - 37

Get sequence
Deep sequencing106 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR391-3p

Accession MIMAT0017538
Previous IDsaly-miR391*
Sequence

68 - 

acgguaucucuccuacguagc

 - 88

Get sequence
Deep sequencing157 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2