Stem-loop sequence aly-MIR393a

AccessionMI0014572 (change log)
DescriptionArabidopsis lyrata miR393a stem-loop
Gene family MIPF0000083; MIR393
Stem-loop
      a  ua     a              c    u     uaauaaaggugaauuaccccaaucuuuucuuaau 
5' agc ac  gagga ggauccaaagggau gcau gaucc                                  a
   ||| ||  ||||| |||||||||||||| |||| |||||                                   
3' ucg ug  uuccu cuuagguuucucua cgua cuagg                                  a
      a  gc     a              u    -     uuuugguucguuuaaaaaaacuaaacaaacgauu 
Get sequence
Deep sequencing
24 reads, 500 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 19396119-19396265 [+]
intergenic
Database links

Mature sequence aly-miR393a-5p

Accession MIMAT0017539
Previous IDsaly-miR393a
Sequence

18 - 

uccaaagggaucgcauugaucc

 - 39

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR393a-3p

Accession MIMAT0017540
Previous IDsaly-miR393a*
Sequence

112 - 

aucaugcuaucucuuuggauu

 - 132

Get sequence
Deep sequencing19 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2