Stem-loop sequence aly-MIR393b

AccessionMI0014573 (change log)
DescriptionArabidopsis lyrata miR393b stem-loop
Gene family MIPF0000083; MIR393
Stem-loop
      a         a c                 u     ---u  uu    u   uuauuccccaaua    a     cu  uu g 
5' agc acuagagaa g auccaaagggaucgcau gaucc    aa  aagc gau             uuuu uuuuc  ca  c a
   ||| ||||||||| | ||||||||||||||||| |||||    ||  |||| |||             |||| |||||  ||  |  
3' ucg ugguuucuu c uagguuucucuagcgua cuagg    uu  uucg uua             aaaa aaaag  gu  g a
      a         a u                 -     ccuu  cu    u   caaaucuuaaaaa    a     ag  -u a 
Get sequence
Deep sequencing
26 reads, 500 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 17660786-17660954 [+]
intergenic
Database links

Mature sequence aly-miR393b-5p

Accession MIMAT0017541
Previous IDsaly-miR393b
Sequence

18 - 

uccaaagggaucgcauugaucc

 - 39

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR393b-3p

Accession MIMAT0017542
Previous IDsaly-miR393b*
Sequence

134 - 

aucaugcgaucucuuuggauu

 - 154

Get sequence
Deep sequencing19 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2