Stem-loop sequence aly-MIR394b

AccessionMI0014575 (change log)
DescriptionArabidopsis lyrata miR394b stem-loop
Gene family MIPF0000100; MIR394
Stem-loop
          -c      g     a   u    u     ga   -      uuc               ucuauauguauaug 
5' gaucaug  ggguuu acaaa gag cucu acaga  ucu uuggca   uguccaccuccucuc              u
   |||||||  |||||| ||||| ||| |||| |||||  ||| ||||||   |||||||||||||||              a
3' uuaguac  cccaaa uguuu cuu ggga ugucu  aga aaccgu   acagguggaggggag              u
          uc      a     -   u    u     ag   c      uau               uguucugucgcgag 
Get sequence
Deep sequencing
22 reads, 700 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 17011842-17012001 [+]
intergenic
Database links

Mature sequence aly-miR394b-5p

Accession MIMAT0017545
Previous IDsaly-miR394b
Sequence

41 - 

uuggcauucuguccaccucc

 - 60

Get sequence
Deep sequencing22 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR394b-3p

Accession MIMAT0017546
Previous IDsaly-miR394b*
Sequence

102 - 

agguggacauauugccaaca

 - 121

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2