Stem-loop sequence aly-MIR395b

AccessionMI0014576 (change log)
DescriptionArabidopsis lyrata miR395b stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
         -  u c   u         uu         u     a    uca     a 
5' gccaaa ug c cca gaguucccu  aacgcuuca uguua auac   aagcc c
   |||||| || | ||| |||||||||  ||||||||| ||||| ||||   ||||| a
3' cgguuu ac g ggu cucaggggg  uugugaagu acaau uaug   uuugg u
         u  c u   u         gu         c     a    ---     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 10964919-10965029 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR395b
aly-MIR395cGL348713.1: 10968022-10968187 [-]
aly-MIR395bGL348713.1: 10964919-10965029 [-]
Database links

Mature sequence aly-miR395b-5p

Accession MIMAT0017547
Previous IDsaly-miR395b*
Sequence

18 - 

guucccuuuaacgcuucauug

 - 38

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR395b-3p

Accession MIMAT0017548
Previous IDsaly-miR395b
Sequence

75 - 

cugaaguguuuggggggacuc

 - 95

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2