Stem-loop sequence aly-MIR395d

AccessionMI0014578 (change log)
DescriptionArabidopsis lyrata miR395d stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
   -acaaaauauaau  g        u c  ua                    u    aauuu    uuc      
5'              uc acuagaug c uc  gaguucucccgaacacuuca ugga     guua   gguaa 
                || |||||||| | ||  |||||||||||||||||||| ||||     ||||   |||| a
3'              ag ugguuuac g ag  cucaaggggguuugugaagu accu     uaau   ccauc 
   uguaccgaacugu  -        u u  gc                    c    -----    uaa      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 13997965-13998104 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR395d
aly-MIR395hGL348714.1: 14006209-14006343 [+]
aly-MIR395gGL348714.1: 14005416-14005520 [-]
aly-MIR395fGL348714.1: 14002867-14002993 [+]
aly-MIR395eGL348714.1: 14000953-14001057 [-]
aly-MIR395dGL348714.1: 13997965-13998104 [-]
Database links

Mature sequence aly-miR395d-5p

Accession MIMAT0017551
Previous IDsaly-miR395d*
Sequence

33 - 

guucucccgaacacuucauug

 - 53

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR395d-3p

Accession MIMAT0017552
Previous IDsaly-miR395d
Sequence

90 - 

cugaaguguuugggggaacuc

 - 110

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2