Stem-loop sequence aly-MIR395e

AccessionMI0014579 (change log)
DescriptionArabidopsis lyrata miR395e stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
           uu   ua         ug         u      u     cuuu 
5' gucggaug  ucc  gaguuccuc  agcacuuca uggaga accau    u
   ||||||||  |||  |||||||||  ||||||||| |||||| |||||     
3' uagcuuac  agg  cucaagggg  uugugaagu aucuuu uggua    a
           uc   cc         gu         c      -     aacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 14000953-14001057 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR395e
aly-MIR395hGL348714.1: 14006209-14006343 [+]
aly-MIR395gGL348714.1: 14005416-14005520 [-]
aly-MIR395fGL348714.1: 14002867-14002993 [+]
aly-MIR395eGL348714.1: 14000953-14001057 [-]
aly-MIR395dGL348714.1: 13997965-13998104 [-]
Database links

Mature sequence aly-miR395e-5p

Accession MIMAT0017553
Previous IDsaly-miR395e*
Sequence

18 - 

guuccucugagcacuucauug

 - 38

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR395e-3p

Accession MIMAT0017554
Previous IDsaly-miR395e
Sequence

70 - 

cugaaguguuugggggaacuc

 - 90

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2