Stem-loop sequence aly-MIR395f

AccessionMI0014580 (change log)
DescriptionArabidopsis lyrata miR395f stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
       a     u   u                    u     -a  cu   -   ucuaa    a 
5' guca auguc ccu gaguucccuuaaacgcuuua uguuc  ca  uug uug     gauc a
   |||| ||||| ||| |||||||||||||||||||| |||||  ||  ||| |||     ||||  
3' cggu uacag gga cucagggggguuugugaagu acaag  gu  aac aac     cuag u
       a     u   u                    c     ca  cu   u   -uuag    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 14002867-14002993 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR395f
aly-MIR395dGL348714.1: 13997965-13998104 [-]
aly-MIR395eGL348714.1: 14000953-14001057 [-]
aly-MIR395fGL348714.1: 14002867-14002993 [+]
aly-MIR395gGL348714.1: 14005416-14005520 [-]
aly-MIR395hGL348714.1: 14006209-14006343 [+]
Database links

Mature sequence aly-miR395f-5p

Accession MIMAT0017555
Previous IDsaly-miR395f*
Sequence

18 - 

guucccuuaaacgcuuuauug

 - 38

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR395f-3p

Accession MIMAT0017556
Previous IDsaly-miR395f
Sequence

92 - 

cugaaguguuuggggggacuc

 - 112

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2